Overview
NameMedtr0001s0010.1
Unique NameMedtr0001s0010.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length213
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF09752.43537-37401-68101-17934.28.1e-1339.03.8e-10

Homology
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|302812275|ref|XP_002987825.1| (hypothetical protein SELMODRAFT_235364 [Selaginella moellendorffii] >gi|300144444|gb|EFJ11128.1| hypothetical protein SELMODRAFT_235364 [Selaginella moellendorffii])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|302821230|ref|XP_002992279.1| (hypothetical protein SELMODRAFT_236489 [Selaginella moellendorffii] >gi|300139929|gb|EFJ06660.1| hypothetical protein SELMODRAFT_236489 [Selaginella moellendorffii])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|475577823|gb|EMT17940.1| (hypothetical protein F775_07360 [Aegilops tauschii])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|356500465|ref|XP_003519052.1| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein C4orf29 homolog [Glycine max])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|218190244|gb|EEC72671.1| (hypothetical protein OsI_06224 [Oryza sativa Indica Group])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|222622365|gb|EEE56497.1| (hypothetical protein OsJ_05743 [Oryza sativa Japonica Group])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|116789020|gb|ABK25086.1| (unknown [Picea sitchensis])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|474313348|gb|EMS61993.1| (hypothetical protein TRIUR3_24612 [Triticum urartu])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|115444807|ref|NP_001046183.1| (Os02g0195000 [Oryza sativa Japonica Group] >gi|49388113|dbj|BAD25244.1| unknown protein [Oryza sativa Japonica Group] >gi|113535714|dbj|BAF08097.1| Os02g0195000 [Oryza sativa Japonica Group] >gi|215734815|dbj|BAG95537.1| unnamed protein product [Oryza sativa Japonica Group])
BLAST of Medtr0001s0010.1 vs. NCBI nr
Match: gi|413936215|gb|AFW70766.1| (hypothetical protein ZEAMMB73_402274 [Zea mays] >gi|413936216|gb|AFW70767.1| hypothetical protein ZEAMMB73_402274 [Zea mays])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0010.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|302812275|ref|XP_002987825.1|1.105610e-2159.49hypothetical protein SELMODRAFT_235364 [Selaginell... [more]
gi|302821230|ref|XP_002992279.1|1.196870e-2159.49hypothetical protein SELMODRAFT_236489 [Selaginell... [more]
gi|475577823|gb|EMT17940.1|1.256030e-2156.96hypothetical protein F775_07360 [Aegilops tauschii... [more]
gi|356500465|ref|XP_003519052.1|1.485590e-2160.76PREDICTED: LOW QUALITY PROTEIN: uncharacterized pr... [more]
gi|218190244|gb|EEC72671.1|1.869640e-2156.96hypothetical protein OsI_06224 [Oryza sativa Indic... [more]
gi|222622365|gb|EEE56497.1|1.888820e-2156.96hypothetical protein OsJ_05743 [Oryza sativa Japon... [more]
gi|116789020|gb|ABK25086.1|2.182060e-2159.49unknown [Picea sitchensis][more]
gi|474313348|gb|EMS61993.1|3.011090e-2156.96hypothetical protein TRIUR3_24612 [Triticum urartu... [more]
gi|115444807|ref|NP_001046183.1|3.382650e-2156.96Os02g0195000 [Oryza sativa Japonica Group] >gi|493... [more]
gi|413936215|gb|AFW70766.1|3.786510e-2158.23hypothetical protein ZEAMMB73_402274 [Zea mays] >g... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0010.1 ID=Medtr0001s0010.1|Name=Medtr0001s0010.1|organism=Medicago truncatula|type=mRNA|length=213bp
ACCGGGGACTATACATTTGAAAGAATACTACGTCTTGGGGGTCCATTGGT
GAAGGAAAACATCGCAACCATGGTGGTTCTTGAGAGCGTGGTGCAACTTT
TGTGTGTCACTGACTTCCTTCAATTAGGAAGAGCAACCATTGAAGAGGCA
CGCAGTCTGTTACACTGGTTGGACTTTGAGGCAGGTTTCGGCAAGATGGG
TGTATTGAATTAG
back to top