Overview
NameMedtr0001s0070.1
Unique NameMedtr0001s0070.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length624
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF03372.1827075-2744963-187124-25123.82.3e-0924.02.9e-05

Homology
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|470132058|ref|XP_004301904.1| (PREDICTED: uncharacterized protein LOC101292910 [Fragaria vesca subsp. vesca])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|470140083|ref|XP_004305774.1| (PREDICTED: uncharacterized protein LOC101293221 [Fragaria vesca subsp. vesca])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|332322102|emb|CCA65997.1| (hypothetical protein [Beta vulgaris subsp. vulgaris])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|590632292|ref|XP_007027800.1| (Uncharacterized protein TCM_022640 [Theobroma cacao] >gi|508716405|gb|EOY08302.1| Uncharacterized protein TCM_022640 [Theobroma cacao])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|590674977|ref|XP_007039317.1| (Uncharacterized protein TCM_015594 [Theobroma cacao] >gi|508776562|gb|EOY23818.1| Uncharacterized protein TCM_015594 [Theobroma cacao])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|4335720|gb|AAD17398.1| (putative non-LTR retroelement reverse transcriptase [Arabidopsis thaliana])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|590634284|ref|XP_007028332.1| (Uncharacterized protein TCM_024073 [Theobroma cacao] >gi|508716937|gb|EOY08834.1| Uncharacterized protein TCM_024073 [Theobroma cacao])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|460410377|ref|XP_004250606.1| (PREDICTED: uncharacterized protein LOC101247390 [Solanum lycopersicum])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|590627508|ref|XP_007026456.1| (Uncharacterized protein TCM_021520 [Theobroma cacao] >gi|508715061|gb|EOY06958.1| Uncharacterized protein TCM_021520 [Theobroma cacao])
BLAST of Medtr0001s0070.1 vs. NCBI nr
Match: gi|460375573|ref|XP_004233579.1| (PREDICTED: uncharacterized protein LOC101260201 [Solanum lycopersicum])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0070.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|470132058|ref|XP_004301904.1|3.014980e-2940.00PREDICTED: uncharacterized protein LOC101292910 [F... [more]
gi|470140083|ref|XP_004305774.1|3.032240e-1939.29PREDICTED: uncharacterized protein LOC101293221 [F... [more]
gi|332322102|emb|CCA65997.1|5.477440e-1629.06hypothetical protein [Beta vulgaris subsp. vulgari... [more]
gi|590632292|ref|XP_007027800.1|2.735600e-1533.15Uncharacterized protein TCM_022640 [Theobroma caca... [more]
gi|590674977|ref|XP_007039317.1|4.804780e-1529.19Uncharacterized protein TCM_015594 [Theobroma caca... [more]
gi|4335720|gb|AAD17398.1|7.479720e-1531.36putative non-LTR retroelement reverse transcriptas... [more]
gi|590634284|ref|XP_007028332.1|1.550350e-1430.86Uncharacterized protein TCM_024073 [Theobroma caca... [more]
gi|460410377|ref|XP_004250606.1|4.107250e-1329.85PREDICTED: uncharacterized protein LOC101247390 [S... [more]
gi|590627508|ref|XP_007026456.1|1.349520e-1230.48Uncharacterized protein TCM_021520 [Theobroma caca... [more]
gi|460375573|ref|XP_004233579.1|4.720450e-1228.19PREDICTED: uncharacterized protein LOC101260201 [S... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR005135Endonuclease/exonuclease/phosphataseSUPERFAMILY56219DNase I-likecoord: 42..195
score: 1.3
NoneNo IPR availableGENE3D3.60.10.10no descriptioncoord: 49..194
score: 3.9

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0070.1 ID=Medtr0001s0070.1|Name=Medtr0001s0070.1|organism=Medicago truncatula|type=mRNA|length=624bp
ATGATTGATGTTTCCCGAATTTCGGACTTGTATTGGAGGAGTATTGGGGT
AGCTAATTTTTGTGTGAATAATAGAGGTTCGGCGCTTCCAAATCTGTGGG
CTTTATGGGGGAACACAATCAGTCCCTCGGTGATTTTTGTCTCTTCACAA
TGTATTATTTTGGAACTCTCTATTGATAATAATAATGTTTATGTTGCGGC
TGTTTATGCAAGCACCAATTATTTAACTCGTCGTGATCTGTGGGCTGATC
TTACTCTTGAGATTGGTAGACATACAGGACCTTGGCTCTTCTTAGGAAAT
TTTAACGCTATACTTGGTGCCCATGAGAAGCGGGGTCGTCGTCCTCCGCC
TCCATTGTCGTGTATGGATTTTCTTCATTGGTCAAATGCTAATTTATTAT
CCCACCTTCCCTCCTTTGATTCATTTTTCACTTGGTCTAATGGGAGGCTC
GGTTTAGAGAATGTAGCCCTCCGTCTGGATCGTGCTATTTGCAATATTGA
TTGGTTGAATCTTTGGCAGCGTACTACTTGTACTTCTCTGGTTCGTCACC
ATTCGGATCACCATCCTATTTTACTTTCTGTTGATAAGGCTAATAATGGG
CAGGCCGTTCCTTTTAAATTTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR005135Endonuclease/exonuclease/phosphatase
noIPRunintegrated