Overview
NameMedtr0001s0160.1
Unique NameMedtr0001s0160.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length258
Homology
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|460409612|ref|XP_004250232.1| (PREDICTED: 60S ribosomal export protein NMD3-like [Solanum lycopersicum])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|590649583|ref|XP_007032443.1| (Nonsense-mediated mRNA decay NMD3 family protein isoform 2 [Theobroma cacao] >gi|590649587|ref|XP_007032444.1| Nonsense-mediated mRNA decay NMD3 family protein isoform 2 [Theobroma cacao] >gi|508711472|gb|EOY03369.1| Nonsense-mediated mRNA decay NMD3 family protein isoform 2 [Theobroma cacao] >gi|508711473|gb|EOY03370.1| Nonsense-mediated mRNA decay NMD3 family protein isoform 2 [Theobroma cacao])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|590649579|ref|XP_007032442.1| (Nonsense-mediated mRNA decay NMD3 family protein isoform 1 [Theobroma cacao] >gi|508711471|gb|EOY03368.1| Nonsense-mediated mRNA decay NMD3 family protein isoform 1 [Theobroma cacao])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|356539804|ref|XP_003538383.1| (PREDICTED: 60S ribosomal export protein NMD3-like [Glycine max])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|147798057|emb|CAN60703.1| (hypothetical protein VITISV_003522 [Vitis vinifera])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|224080157|ref|XP_002306035.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|224079509|ref|XP_002305882.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|225430590|ref|XP_002265288.1| (PREDICTED: 60S ribosomal export protein NMD3-like [Vitis vinifera])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|502137510|ref|XP_004503106.1| (PREDICTED: 60S ribosomal export protein NMD3-like [Cicer arietinum])
BLAST of Medtr0001s0160.1 vs. NCBI nr
Match: gi|356569760|ref|XP_003553064.1| (PREDICTED: 60S ribosomal export protein NMD3-like isoform X1 [Glycine max] >gi|571543022|ref|XP_006602021.1| PREDICTED: 60S ribosomal export protein NMD3-like isoform X2 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0160.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|460409612|ref|XP_004250232.1|1.959450e-965.79PREDICTED: 60S ribosomal export protein NMD3-like ... [more]
gi|590649583|ref|XP_007032443.1|4.907890e-963.16Nonsense-mediated mRNA decay NMD3 family protein i... [more]
gi|590649579|ref|XP_007032442.1|5.035240e-963.16Nonsense-mediated mRNA decay NMD3 family protein i... [more]
gi|356539804|ref|XP_003538383.1|1.546190e-863.16PREDICTED: 60S ribosomal export protein NMD3-like ... [more]
gi|147798057|emb|CAN60703.1|2.010070e-863.16hypothetical protein VITISV_003522 [Vitis vinifera... [more]
gi|224080157|ref|XP_002306035.1|2.498240e-860.53predicted protein [Populus trichocarpa][more]
gi|224079509|ref|XP_002305882.1|2.498240e-860.53predicted protein [Populus trichocarpa][more]
gi|225430590|ref|XP_002265288.1|2.517910e-863.16PREDICTED: 60S ribosomal export protein NMD3-like ... [more]
gi|502137510|ref|XP_004503106.1|2.659080e-863.16PREDICTED: 60S ribosomal export protein NMD3-like ... [more]
gi|356569760|ref|XP_003553064.1|3.321620e-863.16PREDICTED: 60S ribosomal export protein NMD3-like ... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 10..19
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0160.1 ID=Medtr0001s0160.1|Name=Medtr0001s0160.1|organism=Medicago truncatula|type=mRNA|length=258bp
ATGTGGTCCATTCAAAGGTGGCCGATTCTTCTAAAATTTCTGTTGTTGCT
GCTGTTTTGGCATCTAGTTCGTTCCAAATTCATAACTTGGCAGTTGATGT
GGCTCCAATGGTTGATGATAAACCCCATTTGTCTTGAGGATTTAATTTGT
TTGCCTCCTAATGCTGCTGCAATTTTGGGAAATATTGGTCCTATTGTGTT
TTGCTCGAATGTTTCTAATGACATGGAATTGGACAGGTACATAGGAAGTA
TTCCTTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated