Overview
NameMedtr0001s0190.1
Unique NameMedtr0001s0190.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length309
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF09713.564258-6441614-661-5396.25.6e-3297.43.4e-28

Homology
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|502121415|ref|XP_004497310.1| (PREDICTED: uncharacterized protein LOC101495981 [Cicer arietinum])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|225453034|ref|XP_002265038.1| (PREDICTED: uncharacterized protein LOC100245098 [Vitis vinifera] >gi|302143639|emb|CBI22392.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|356574983|ref|XP_003555622.1| (PREDICTED: uncharacterized protein LOC100800093 [Glycine max])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|596049458|ref|XP_007220496.1| (hypothetical protein PRUPE_ppa013960mg [Prunus persica] >gi|462416958|gb|EMJ21695.1| hypothetical protein PRUPE_ppa013960mg [Prunus persica])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|255564072|ref|XP_002523034.1| (conserved hypothetical protein [Ricinus communis] >gi|223537717|gb|EEF39338.1| conserved hypothetical protein [Ricinus communis])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|449522175|ref|XP_004168103.1| (PREDICTED: uncharacterized LOC101208991 [Cucumis sativus])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|449466552|ref|XP_004150990.1| (PREDICTED: uncharacterized protein LOC101208991 [Cucumis sativus])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|590564066|ref|XP_007009555.1| (Plant protein 1589 of Uncharacterized protein function [Theobroma cacao] >gi|508726468|gb|EOY18365.1| Plant protein 1589 of Uncharacterized protein function [Theobroma cacao])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|225448835|ref|XP_002282487.1| (PREDICTED: uncharacterized protein LOC100267224 [Vitis vinifera] >gi|296086933|emb|CBI33166.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0001s0190.1 vs. NCBI nr
Match: gi|15233218|ref|NP_191084.1| (uncharacterized protein [Arabidopsis thaliana] >gi|297820286|ref|XP_002878026.1| hypothetical protein ARALYDRAFT_485945 [Arabidopsis lyrata subsp. lyrata] >gi|567186310|ref|XP_006403482.1| hypothetical protein EUTSA_v10010856mg [Eutrema salsugineum] >gi|7019657|emb|CAB75758.1| putative protein [Arabidopsis thaliana] >gi|19310583|gb|AAL85022.1| unknown protein [Arabidopsis thaliana] >gi|24030411|gb|AAN41364.1| unknown protein [Arabidopsis thaliana] >gi|297323864|gb|EFH54285.1| hypothetical protein ARALYDRAFT_485945 [Arabidopsis lyrata subsp. lyrata] >gi|332645835|gb|AEE79356.1| uncharacterized protein AT3G55240 [Arabidopsis thaliana] >gi|557104601|gb|ESQ44935.1| hypothetical protein EUTSA_v10010856mg [Eutrema salsugineum])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0190.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502121415|ref|XP_004497310.1|4.977830e-4982.52PREDICTED: uncharacterized protein LOC101495981 [C... [more]
gi|225453034|ref|XP_002265038.1|6.025700e-4167.96PREDICTED: uncharacterized protein LOC100245098 [V... [more]
gi|356574983|ref|XP_003555622.1|8.377420e-4179.80PREDICTED: uncharacterized protein LOC100800093 [G... [more]
gi|596049458|ref|XP_007220496.1|2.189210e-4073.68hypothetical protein PRUPE_ppa013960mg [Prunus per... [more]
gi|255564072|ref|XP_002523034.1|3.607460e-4076.09conserved hypothetical protein [Ricinus communis] ... [more]
gi|449522175|ref|XP_004168103.1|7.082470e-3973.20PREDICTED: uncharacterized LOC101208991 [Cucumis s... [more]
gi|449466552|ref|XP_004150990.1|2.629120e-3872.16PREDICTED: uncharacterized protein LOC101208991 [C... [more]
gi|590564066|ref|XP_007009555.1|4.491850e-3871.57Plant protein 1589 of Uncharacterized protein func... [more]
gi|225448835|ref|XP_002282487.1|1.907170e-3770.53PREDICTED: uncharacterized protein LOC100267224 [V... [more]
gi|15233218|ref|NP_191084.1|4.446880e-3770.83uncharacterized protein [Arabidopsis thaliana] >gi... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR006476Conserved hypothetical protein CHP01589, plantTIGRFAMsTIGR01589A_thal_3526: uncharacterized plant-specifcoord: 11..67
score: 5.8

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0190.1 ID=Medtr0001s0190.1|Name=Medtr0001s0190.1|organism=Medicago truncatula|type=mRNA|length=309bp
ATGGGGGACTCATCTTCTTCGGCTTCATACATTCACTTGGTGCAGCACCT
GATCGAAAAGTGTTTGATCTTTCACATGACAAAGGAAGAGTGCATGGAAG
CGCTCTCTAAACATGCAAATATAAATCCAACTATAACATCCACTGTGTGG
AATGAGCTAGAGAAGGTGAACAAGGAATTTTTTGAGGCATATAAGATGAA
GCCAAAGAATAATGAAGAGATAATGATGTCCCAGGAAGAGACAACTCGGA
TGTTACAGAAGATGATCTCAGCTTCGGATTCCTCTAAAGGTGCACAACAC
GACGATTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR006476Conserved hypothetical protein CHP01589, plant