Overview
NameMedtr0001s0200.1
Unique NameMedtr0001s0200.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length597
Homology
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356565386|ref|XP_003550922.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356532924|ref|XP_003535019.1| (PREDICTED: uncharacterized protein LOC100795609 [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356506402|ref|XP_003521972.1| (PREDICTED: uncharacterized protein LOC100800774 [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356515310|ref|XP_003526344.1| (PREDICTED: uncharacterized protein LOC100799415 [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|590608114|ref|XP_007021179.1| (Uncharacterized protein TCM_031228 [Theobroma cacao] >gi|508720807|gb|EOY12704.1| Uncharacterized protein TCM_031228 [Theobroma cacao])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356537656|ref|XP_003537341.1| (PREDICTED: uncharacterized protein LOC100813042 [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356518961|ref|XP_003528143.1| (PREDICTED: uncharacterized protein LOC100778359 [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356570179|ref|XP_003553268.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356560755|ref|XP_003548653.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Glycine max])
BLAST of Medtr0001s0200.1 vs. NCBI nr
Match: gi|356503034|ref|XP_003520317.1| (PREDICTED: putative ribonuclease H protein At1g65750-like [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0200.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356565386|ref|XP_003550922.1|8.594030e-1031.39PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|356532924|ref|XP_003535019.1|9.392290e-1031.61PREDICTED: uncharacterized protein LOC100795609 [G... [more]
gi|356506402|ref|XP_003521972.1|2.189580e-930.15PREDICTED: uncharacterized protein LOC100800774 [G... [more]
gi|356515310|ref|XP_003526344.1|1.055690e-827.33PREDICTED: uncharacterized protein LOC100799415 [G... [more]
gi|590608114|ref|XP_007021179.1|2.156510e-823.64Uncharacterized protein TCM_031228 [Theobroma caca... [more]
gi|356537656|ref|XP_003537341.1|6.988730e-826.54PREDICTED: uncharacterized protein LOC100813042 [G... [more]
gi|356518961|ref|XP_003528143.1|7.595550e-839.08PREDICTED: uncharacterized protein LOC100778359 [G... [more]
gi|356570179|ref|XP_003553268.1|9.894710e-829.41PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|356560755|ref|XP_003548653.1|1.420630e-729.08PREDICTED: putative ribonuclease H protein At1g657... [more]
gi|356503034|ref|XP_003520317.1|3.884830e-726.90PREDICTED: putative ribonuclease H protein At1g657... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 195..206
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0200.1 ID=Medtr0001s0200.1|Name=Medtr0001s0200.1|organism=Medicago truncatula|type=mRNA|length=597bp
ATGAGGGCGCATGCCTCTTTATCTGTTACACTTTTACAGTTTGCTGATGA
TACACTTTTGATTGGTGAAAAAAGTTCGGCAAACGTTCGTGCTTTAAAAA
GGGTTATGCTTCTGTTTGAAAAGATTTCTAGGTTGAATGTCAATTTCCAT
AAAAGCTTGTTTGGAATTAATATGGCGGGTAAACTGTCTGGTTGGAAGGG
TCAAAATCATTTTTTGGGTAGTTGGATGATTCTCTTGAAATTTGTATTGT
CTGCCATTCCGGTCTATTTTCTTTCATTTTTCAAAGCTCCCTCAGTTGCG
GAGACGTTTGCTTTGGGGTGGAATTCTAATGGTGAGGCGTGGGAGTGGTG
TAGGAGATTATTTGTGTGTGGGGTGGGGGTTGTTGTTGAGCTTAAGAAAA
TTCCACTTAAGATCAATAATTTTACTTGGCGTTTGTTCTTGAGTAGATTA
GCAACAAAAATGAATCTATTTAGGAGAAACATTTTGGATTATAATGATTC
TTTGTGCACGGCTACTTGTGGCATGGTAGAGGATCAAGACCATTTGTTTT
TTACTTGTGGTTTCTACATTCAACTTTGGCTTTTGATATCGGGTTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated