Overview
NameMedtr0001s0260.1
Unique NameMedtr0001s0260.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length417
Homology
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356560472|ref|XP_003548516.1| (PREDICTED: uncharacterized protein LOC100811554 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356566612|ref|XP_003551524.1| (PREDICTED: uncharacterized protein LOC100805548 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356522885|ref|XP_003530073.1| (PREDICTED: uncharacterized protein LOC100789592 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356561959|ref|XP_003549243.1| (PREDICTED: uncharacterized protein LOC100795062 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356551968|ref|XP_003544344.1| (PREDICTED: uncharacterized protein LOC100804218 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356498995|ref|XP_003518330.1| (PREDICTED: uncharacterized protein LOC100818337 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356524006|ref|XP_003530624.1| (PREDICTED: uncharacterized protein LOC100785887 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356506842|ref|XP_003522184.1| (PREDICTED: uncharacterized protein LOC100786848 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356561241|ref|XP_003548891.1| (PREDICTED: uncharacterized protein LOC100803738 [Glycine max])
BLAST of Medtr0001s0260.1 vs. NCBI nr
Match: gi|356570351|ref|XP_003553353.1| (PREDICTED: uncharacterized protein LOC100790215 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0260.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356560472|ref|XP_003548516.1|3.361640e-2863.86PREDICTED: uncharacterized protein LOC100811554 [G... [more]
gi|356566612|ref|XP_003551524.1|3.744850e-2863.86PREDICTED: uncharacterized protein LOC100805548 [G... [more]
gi|356522885|ref|XP_003530073.1|3.776900e-2863.86PREDICTED: uncharacterized protein LOC100789592 [G... [more]
gi|356561959|ref|XP_003549243.1|3.780850e-2863.86PREDICTED: uncharacterized protein LOC100795062 [G... [more]
gi|356551968|ref|XP_003544344.1|3.800560e-2863.86PREDICTED: uncharacterized protein LOC100804218 [G... [more]
gi|356498995|ref|XP_003518330.1|3.890960e-2863.86PREDICTED: uncharacterized protein LOC100818337 [G... [more]
gi|356524006|ref|XP_003530624.1|4.080040e-2863.86PREDICTED: uncharacterized protein LOC100785887 [G... [more]
gi|356506842|ref|XP_003522184.1|4.115640e-2863.86PREDICTED: uncharacterized protein LOC100786848 [G... [more]
gi|356561241|ref|XP_003548891.1|4.123400e-2863.86PREDICTED: uncharacterized protein LOC100803738 [G... [more]
gi|356570351|ref|XP_003553353.1|4.197210e-2863.86PREDICTED: uncharacterized protein LOC100790215 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0260.1 ID=Medtr0001s0260.1|Name=Medtr0001s0260.1|organism=Medicago truncatula|type=mRNA|length=417bp
ATGGATGTTATTGGACTAGGAGCGGTCCTATACACCGATATGTTCATAAG
GGAAGTTGTAATTTGGGAACTTGGTAGAACCCGTGATACAGGTCAATCCA
TTTCGAAAGGGGTCCGACTGTCCTCGTCCAAAGCCAACTCGTATCTACAA
CACCCGTGCAAACAAACAGAAAGAATATATCAGTTTGACCCAATCCCAAT
GACATATGCGGAGCTACTTCCCATTTTACTCGAGAAGAACCTTGTCAAGA
CCAGAACGCCTCCTCGAGTGCCTAATGAGTTGCTAGTATGGTATCAAGCT
GACCTCTCCTGTGCCTTCCATCAAGGAGCTCCCGGCCACGATGTCGAGCA
CTGTTTCTCATTGAAGATTGAAGTCCAGAAGTTGATTGAAGCTAATATGT
TGCTTTTCGAAGGTTGA
back to top