Overview
NameMedtr0001s0360.1
Unique NameMedtr0001s0360.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length762
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0048229 gametophyte development
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0009555 pollen development
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005737 cytoplasm
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0003677 DNA binding
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00249.26149347-1492049-561-4850.91.5e-1793.26.3e-27
PF13921.1149338-14916212-701-5739.84.6e-1468.33.9e-19

Homology
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|356567058|ref|XP_003551740.1| (PREDICTED: transcription factor MYB90-like [Glycine max])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|356529914|ref|XP_003533531.1| (PREDICTED: transcription factor MYB113-like [Glycine max])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|356529911|ref|XP_003533530.1| (PREDICTED: transcription factor MYB90-like [Glycine max])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|126567782|gb|ABO21070.1| (anthocyanin 2 [Petunia integrifolia])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|126567811|gb|ABO21074.1| (anthocyanin 2 [Petunia x hybrida])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|126567771|gb|ABO21067.1| (anthocyanin 2 [Petunia integrifolia subsp. inflata])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|126567784|gb|ABO21071.1| (anthocyanin 2 [Petunia integrifolia])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|7673084|gb|AAF66727.1|AF146702_1 (An2 protein [Petunia x hybrida])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|126567773|gb|ABO21068.1| (anthocyanin 2 [Petunia integrifolia])
BLAST of Medtr0001s0360.1 vs. NCBI nr
Match: gi|126567775|gb|ABO21069.1| (anthocyanin 2 [Petunia integrifolia])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0360.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356567058|ref|XP_003551740.1|5.416960e-6661.63PREDICTED: transcription factor MYB90-like [Glycin... [more]
gi|356529914|ref|XP_003533531.1|1.134930e-6463.64PREDICTED: transcription factor MYB113-like [Glyci... [more]
gi|356529911|ref|XP_003533530.1|1.402320e-6462.73PREDICTED: transcription factor MYB90-like [Glycin... [more]
gi|126567782|gb|ABO21070.1|1.465910e-6472.41anthocyanin 2 [Petunia integrifolia][more]
gi|126567811|gb|ABO21074.1|1.497840e-6472.41anthocyanin 2 [Petunia x hybrida][more]
gi|126567771|gb|ABO21067.1|4.846280e-6470.20anthocyanin 2 [Petunia integrifolia subsp. inflata... [more]
gi|126567784|gb|ABO21071.1|5.282390e-6471.72anthocyanin 2 [Petunia integrifolia][more]
gi|7673084|gb|AAF66727.1|AF146702_15.339600e-6470.20An2 protein [Petunia x hybrida][more]
gi|126567773|gb|ABO21068.1|5.397420e-6470.20anthocyanin 2 [Petunia integrifolia][more]
gi|126567775|gb|ABO21069.1|5.529410e-6470.20anthocyanin 2 [Petunia integrifolia][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001005SANT domain, DNA bindingSMARTSM00717no descriptioncoord: 8..58
score: 2.8e-12coord: 61..109
score: 9.7
IPR009057Homeodomain-likeSUPERFAMILY46689Homeodomain-likecoord: 9..108
score: 1.2
IPR012287Homeodomain-relatedGENE3D1.10.10.60no descriptioncoord: 6..63
score: 4.9e-19coord: 64..110
score: 4.7
IPR017930Transcription regulator HTH, Myb-type, DNA-bindingPROFILEPS51294HTH_MYBcoord: 57..111
score: 23.974coord: 1..56
score: 16
NoneNo IPR availableSEGsegsegcoord: 117..126
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0360.1 ID=Medtr0001s0360.1|Name=Medtr0001s0360.1|organism=Medicago truncatula|type=mRNA|length=762bp
ATGGATATGCCCAGAGGCGTGAGAAAAGGTGCCTGGACATACGAGGAAGA
TAAGCTACTCAAGGCTTGCATTGACAAGTATGGGGAAGGAAAATGGCATT
TAGTTCCTCAAAGAGCAGAATTGAATAGGTGCCGCAAAAGCTGTAGATTG
AGGTGGTTAAATTATTTAAGCCCCAACATCAAAAGGGAAAGCTTTGCTGA
GGATGAAGTCGATATGATCCTAAGGTTACACAAACTTCTAGGGAATAGAT
GGTCATTGATTGCTGGAAGGCTTCCGGGAAGAACAGCTAATGATGTAAAG
AACTATTGGCACACACACTTGCACAAGAAGGTGGTTTCAAGAACACAAGA
AGAAAAGAAAGAAAAAACTAAGGAAACCATGAAATTTCATGAAATTATTA
GACCTCAACCTCGAACTTTCTCAACTCATTCACCTTCGTTGAATGGGAAA
CATAATATTAACGCGACACCAATTGTGGCAATTTCAACTCAACACTGTGA
AGTCTCGCCAAATCGTGATAATAAAGAGATTACGGTTCCAAACCAAATTG
GTAGAGATATTGTTGGTGTTTCAGAACCAAGTCTTGGTAATGCTCCAATA
CCGTGTGCAATGTGGTGGGACGGTTTATTGAACTTGCAATGTGGTGAGAA
AATTGGTTCAGGCTCTTCATTACAAGAGGAGAACTTTATTGAGTTTCCAA
ATGTGGATGACTCCTTTTGGGATTTCAACCTTTGTGATTACGATTCTCTT
TTAGATCATTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001005SANT domain, DNA binding
IPR009057Homeodomain-like
IPR012287Homeodomain-related
IPR017930Transcription regulator HTH, Myb-type, DNA-binding
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0003677DNA binding
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0005737cytoplasm
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0009555pollen development
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048229gametophyte development
GO:0048856anatomical structure development