Overview
NameMedtr0001s0380.1
Unique NameMedtr0001s0380.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length204
Homology
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|356552035|ref|XP_003544377.1| (PREDICTED: uncharacterized protein LOC100778023, partial [Glycine max])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|356551088|ref|XP_003543910.1| (PREDICTED: uncharacterized protein LOC100777299 [Glycine max])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|356495621|ref|XP_003516673.1| (PREDICTED: uncharacterized protein LOC100801435 [Glycine max])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|356552033|ref|XP_003544376.1| (PREDICTED: uncharacterized protein LOC100777486 [Glycine max])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|356503764|ref|XP_003520674.1| (PREDICTED: uncharacterized protein LOC100783109 [Glycine max])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|460395114|ref|XP_004243133.1| (PREDICTED: uncharacterized protein LOC101257680 [Solanum lycopersicum])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|147822180|emb|CAN65810.1| (hypothetical protein VITISV_013604 [Vitis vinifera])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|147782413|emb|CAN70696.1| (hypothetical protein VITISV_032360 [Vitis vinifera])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|147789529|emb|CAN69758.1| (hypothetical protein VITISV_013641 [Vitis vinifera])
BLAST of Medtr0001s0380.1 vs. NCBI nr
Match: gi|147776665|emb|CAN65430.1| (hypothetical protein VITISV_005125 [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0380.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|356552035|ref|XP_003544377.1|5.444680e-1058.62PREDICTED: uncharacterized protein LOC100778023, p... [more]
gi|356551088|ref|XP_003543910.1|7.395650e-1058.62PREDICTED: uncharacterized protein LOC100777299 [G... [more]
gi|356495621|ref|XP_003516673.1|7.612020e-1058.62PREDICTED: uncharacterized protein LOC100801435 [G... [more]
gi|356552033|ref|XP_003544376.1|7.762370e-1058.62PREDICTED: uncharacterized protein LOC100777486 [G... [more]
gi|356503764|ref|XP_003520674.1|7.773800e-1058.62PREDICTED: uncharacterized protein LOC100783109 [G... [more]
gi|460395114|ref|XP_004243133.1|8.888930e-1066.00PREDICTED: uncharacterized protein LOC101257680 [S... [more]
gi|147822180|emb|CAN65810.1|4.192750e-947.54hypothetical protein VITISV_013604 [Vitis vinifera... [more]
gi|147782413|emb|CAN70696.1|4.797270e-955.10hypothetical protein VITISV_032360 [Vitis vinifera... [more]
gi|147789529|emb|CAN69758.1|5.300760e-951.02hypothetical protein VITISV_013641 [Vitis vinifera... [more]
gi|147776665|emb|CAN65430.1|7.163980e-951.02hypothetical protein VITISV_005125 [Vitis vinifera... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0380.1 ID=Medtr0001s0380.1|Name=Medtr0001s0380.1|organism=Medicago truncatula|type=mRNA|length=204bp
ATGTTCCACAAGCAAAGGGCTTTGTGGTTGAAGTTGTTTCTTGGAAAGCT
CAAGTCAAAGTGGTATAGACTATTCTTGATCAAAAGTGTGTCACCTCATG
GAGCTGTTGAGTTGATGACACCTGAAGGTGACCGAAGTTTCAAAGTAAAT
TGGCAGAGAGTTAAGCCATATCTGGGTGGCGACCTACCAAAAGCGAGGGT
ATGA
back to top