Overview
NameMedtr0001s0430.1
Unique NameMedtr0001s0430.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length2490
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0005488 binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF01535.15194596-194516340-3662-2815.82.6e-06114.43.1e-34
PF12854.2193837-193745593-6233-3328.81.6e-1072.98.8e-21
PF13041.1194350-194216422-4661-4536.87.4e-13131.75.8e-39
PF13812.1194599-194513339-3672-3012.73.2e-05101.05.1e-30

Homology
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|502116723|ref|XP_004495567.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g30610, chloroplastic-like [Cicer arietinum])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|356541058|ref|XP_003539000.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g30610, chloroplastic-like [Glycine max])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|590561275|ref|XP_007008764.1| (Pentatricopeptide repeat-containing protein isoform 1 [Theobroma cacao] >gi|508725677|gb|EOY17574.1| Pentatricopeptide repeat-containing protein isoform 1 [Theobroma cacao])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|255586263|ref|XP_002533784.1| (pentatricopeptide repeat-containing protein, putative [Ricinus communis] >gi|223526285|gb|EEF28597.1| pentatricopeptide repeat-containing protein, putative [Ricinus communis])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|595883513|ref|XP_007212803.1| (hypothetical protein PRUPE_ppa001195mg [Prunus persica] >gi|462408668|gb|EMJ14002.1| hypothetical protein PRUPE_ppa001195mg [Prunus persica])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|225444167|ref|XP_002268516.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g30610, chloroplastic-like [Vitis vinifera])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|470118686|ref|XP_004295453.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g30610, chloroplastic-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|224061585|ref|XP_002300553.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|449435940|ref|XP_004135752.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g30610, chloroplastic-like [Cucumis sativus])
BLAST of Medtr0001s0430.1 vs. NCBI nr
Match: gi|297740901|emb|CBI31083.3| (unnamed protein product [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0430.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502116723|ref|XP_004495567.1|0.000000e+072.48PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|356541058|ref|XP_003539000.1|0.000000e+065.15PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|590561275|ref|XP_007008764.1|0.000000e+056.23Pentatricopeptide repeat-containing protein isofor... [more]
gi|255586263|ref|XP_002533784.1|0.000000e+055.58pentatricopeptide repeat-containing protein, putat... [more]
gi|595883513|ref|XP_007212803.1|0.000000e+055.38hypothetical protein PRUPE_ppa001195mg [Prunus per... [more]
gi|225444167|ref|XP_002268516.1|0.000000e+054.61PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|470118686|ref|XP_004295453.1|0.000000e+051.80PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|224061585|ref|XP_002300553.1|0.000000e+061.20predicted protein [Populus trichocarpa][more]
gi|449435940|ref|XP_004135752.1|0.000000e+059.70PREDICTED: pentatricopeptide repeat-containing pro... [more]
gi|297740901|emb|CBI31083.3|0.000000e+068.48unnamed protein product [Vitis vinifera][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002885Pentatricopeptide repeatTIGRFAMsTIGR00756PPR: pentatricopeptide repeat domaincoord: 339..374
score: 0.00035coord: 425..459
score: 4.8e-06coord: 460..493
score: 1.4coord: 494..528
score: 6.1e-05coord: 564..597
score: 0.2coord: 598..632
score: 6.7e-08coord: 645..679
score: 0.
IPR002885Pentatricopeptide repeatPROFILEPS51375PPRcoord: 299..329
score: 5.240coord: 337..367
score: 7.695coord: 373..403
score: 5.777coord: 423..457
score: 11.345coord: 492..526
score: 10.468coord: 458..488
score: 6.412coord: 596..626
score: 11.718coord: 562..592
score: 6.500coord: 527..561
score: 5.919coord: 643..677
score: 9
IPR011990Tetratricopeptide-like helicalGENE3D1.25.40.10no descriptioncoord: 430..625
score: 5.1
NoneNo IPR availableCOILcoilcoiled-coilcoord: 261..282
score
NoneNo IPR availableSEGsegsegcoord: 23..38
score: NAcoord: 109..128
score: NAcoord: 146..157
score
NoneNo IPR availableSUPERFAMILY48452TPR-likecoord: 480..633
score: 2e-08coord: 341..518
score: 0.

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0430.1 ID=Medtr0001s0430.1|Name=Medtr0001s0430.1|organism=Medicago truncatula|type=mRNA|length=2490bp
ATGGTAGTTATTAGCTTAGAATTCAACGGGAACTTCACTGCCTCTGCTTT
GCATTATGGTGCCACTTCTTTCTCTTTCTCTTCCTCTTCCTATCCACTTC
TTTCTCGTTCTCGAAACCTCAATTTTAACCCAGTTATGGTTTCCATGAAA
AATAACGAGCCTCTTCATAATGAATTGGAATTTAAACCATCATTTGATCA
ATATTTGAAGGCTATGGAATCTGTTAGAAACAACACACTAGTCAAAAAGG
GTCTTCATAACGAGTTTCAAGATGATGAAGTATCCTCCTCCAAAGGAAAA
CAGAATAAAGGGTTTAGGAATGAAAGGAAGCAGAAATCTGATGGTTCGAA
GCGCCGGAGTCGTAGTTTAGACTCAAAATCTGATGAGGTTAGTAGTATTA
GAGAAAAAGATAACATAATTAAGTCGAATTTGAACGGTGGCCGAGGTGGG
AGTGTTGTTGAGAGAGGAGTTACTTATGATTTAGAACAACAAGTTGTTAG
TAGTATTAGAGAAAGAAATAACAGCAGAAAGGGTGGTAAAACCCTTGGTG
GTGGTGATAATTTTGTAGATAGAAAAAAACCTATGGATAGAGGGCCTGGT
AAAAGATATAGTGAAATTGAGAGTATGACGAATAGAAATGGACGGAGGAA
TGTCAAGTCGAATGGAACCAGTAAGCGTTTTCTTAATAGGGGTTATGATT
CTGATGATTTGGTGGTTGAACGAGCAGCATTCAAGAATCTTGAGGATCCT
AACAATGTTATCAGTAAGGCACACTTTTCGCATAAAGAAATGGAGGAGAG
AATCCAGAAGCTAGCTAAACAGTTGAATGGTGTGGATATCAATTTACCTG
AATGGATGTTTTCTAAGATGATCAGAAGTGCAAAGCTCAAATTTAATGAC
TATTCCATAAGAAGGCTTATCACAATCTTAGGTAATCTAGGAAACTGGCA
GCGAGTGATACAAGTCATTGAATGGCTTCAAACACGTGAGCGTTTTCAAT
CCCATAAGCCAAGGCATGTATATAATGCTGCACTTGACGCACTTGGGAAG
TTGAGGAGACCTGTGGAAGCATTGAATATATTTCATGCAATGCAGCAACA
AATGTCGACATATCCTGACTTAGTAGCTTATCATAGTATTGCTGTTACTC
TTGGACAAGCAGGGCACATGAAGCAACTCTTTGATGTGATAGATATCATG
CAATCTCCACCAAAGAAGAAGTTCAATAAAGGGATATTCGAGAATTGGGA
CCCAAGGCTGGAACCTGATATCGTAGTTTATAATGCAGTCCTTAATGCAT
GTGTTAAGGGGAAACAGTGGGAAGGAGCATTTTGGGTTTTACAGCAGTTA
AAGAAGCAGAACATACAACCTTCTGCCGCGACATATGGTCTAGTTATGGA
GGTGATGTTTTCATGTGGCAAGTACAACTTGGTTCATGATTTTTTTAGAA
AACTTCAGAAATCTTCTATTCCTAATCCATTGACATATAGAGTTCTCGTG
AATACATTTTGGAAAGAGGGAAAAATTGACGAGGCTGTCTCGGCTGTCCA
TGAAATGGAAAGACGTGGAATTGTTGGTTCTGCTTCACTTTATTATGATC
TAGCTCGATGCCTCTGTGCAGCTGGACGAAGTTGCGAGGCACTGATGCAG
ATAGACAAGATATGTAAGGTTGCAAATAAACCACTGGTGGTGACCTACAC
TGGCTTGATGCAAGCAAGTCTAGACTCTGGAAACATTCAAGACGGATCTT
ACATTTTTGAGAAAATGAAGGACATTTGTGCTCCGAATCTGGTTACTTAC
AACATAATGCTGAAAGCATACGTTGATCATGGGATGTTTCGAGAAGCTAA
AGAGTTATTTGAGCAAATGTTAGAAAACACAAATCATCTGAGTAGAAATG
ATGATTACAAAATGCGAGTGATACCAGATATATACACATTTAATACCATG
TTAGATGCATGTGCTGCAGAAAAAAGATGGGATTATTTTGACCATGTTTA
CCAGAGGATGCTGTACCATGGTTATCACTTCAATCCAAAACGACATCTTC
GAATGATACTGGAGGCTTCAAGAGCTGGAAAGGAAGAGCCATTGGAGATA
ACATGGAACCACTTGGCCGCTACAGATCGAATTCCACCAGTTTCTCTAAT
CAAGGAGAGGTTCTGTACAAAGCTTGAGAAGGATGATTATATTATTGCCC
TCCAATGCATCACAAATAGCACACCAAAAGATTTGCATCCATTTTCAAAG
TCGTCATGGTTGAATCTATTCAAAGAAAATTCTCAACGGTTTCAGAAGGA
TACAGTTGTCAGGCTTATGAATGCAGCCAGTAATATAATTTCCAATATTA
GTGTGCCAAATCCAGCACTTGTTTGTTTAATTCAATCATGCAAAGATTTT
TGTTTTGCCACTGATCTCAGTGCAGCTGACATGGATTCAGCAAACAATGT
ATTTGCATTAGAAAGCAAACAGGAAGTAAACCAATACTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002885Pentatricopeptide repeat
IPR011990Tetratricopeptide-like helical
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005488binding