Overview
NameMedtr0001s0570.2
Unique NameMedtr0001s0570.2
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length4185
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0032774 RNA biosynthetic process
biological_process GO:0016070 RNA metabolic process
biological_process GO:0019438 aromatic compound biosynthetic process
biological_process GO:0065007 biological regulation
biological_process GO:0008150 biological_process
biological_process GO:0009058 biosynthetic process
biological_process GO:0006725 cellular aromatic compound metabolic process
biological_process GO:0044249 cellular biosynthetic process
biological_process GO:0034645 cellular macromolecule biosynthetic process
biological_process GO:0044260 cellular macromolecule metabolic process
biological_process GO:0044237 cellular metabolic process
biological_process GO:0044271 cellular nitrogen compound biosynthetic process
biological_process GO:0034641 cellular nitrogen compound metabolic process
biological_process GO:0009987 cellular process
biological_process GO:0010467 gene expression
biological_process GO:0018130 heterocycle biosynthetic process
biological_process GO:0046483 heterocycle metabolic process
biological_process GO:0009059 macromolecule biosynthetic process
biological_process GO:0043170 macromolecule metabolic process
biological_process GO:0008152 metabolic process
biological_process GO:0006807 nitrogen compound metabolic process
biological_process GO:0090304 nucleic acid metabolic process
biological_process GO:0034654 nucleobase-containing compound biosynthetic process
biological_process GO:0006139 nucleobase-containing compound metabolic process
biological_process GO:1901362 organic cyclic compound biosynthetic process
biological_process GO:1901360 organic cyclic compound metabolic process
biological_process GO:1901576 organic substance biosynthetic process
biological_process GO:0071704 organic substance metabolic process
biological_process GO:0051254 positive regulation of RNA metabolic process
biological_process GO:0048518 positive regulation of biological process
biological_process GO:0009891 positive regulation of biosynthetic process
biological_process GO:0031328 positive regulation of cellular biosynthetic process
biological_process GO:0031325 positive regulation of cellular metabolic process
biological_process GO:0048522 positive regulation of cellular process
biological_process GO:0010628 positive regulation of gene expression
biological_process GO:0010557 positive regulation of macromolecule biosynthetic process
biological_process GO:0010604 positive regulation of macromolecule metabolic process
biological_process GO:0009893 positive regulation of metabolic process
biological_process GO:0051173 positive regulation of nitrogen compound metabolic process
biological_process GO:0045935 positive regulation of nucleobase-containing compound metabolic process
biological_process GO:0045893 positive regulation of transcription, DNA-templated
biological_process GO:0044238 primary metabolic process
biological_process GO:2001141 regulation of RNA biosynthetic process
biological_process GO:0051252 regulation of RNA metabolic process
biological_process GO:0050789 regulation of biological process
biological_process GO:0009889 regulation of biosynthetic process
biological_process GO:0031326 regulation of cellular biosynthetic process
biological_process GO:2000112 regulation of cellular macromolecule biosynthetic process
biological_process GO:0031323 regulation of cellular metabolic process
biological_process GO:0050794 regulation of cellular process
biological_process GO:0010468 regulation of gene expression
biological_process GO:0010556 regulation of macromolecule biosynthetic process
biological_process GO:0060255 regulation of macromolecule metabolic process
biological_process GO:0019222 regulation of metabolic process
biological_process GO:0051171 regulation of nitrogen compound metabolic process
biological_process GO:0019219 regulation of nucleobase-containing compound metabolic process
biological_process GO:0080090 regulation of primary metabolic process
biological_process GO:0006355 regulation of transcription, DNA-templated
biological_process GO:0006366 transcription from RNA polymerase II promoter
biological_process GO:0006351 transcription, DNA-templated
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
cellular_component GO:0043231 intracellular membrane-bounded organelle
cellular_component GO:0043229 intracellular organelle
cellular_component GO:0044424 intracellular part
cellular_component GO:0043227 membrane-bounded organelle
cellular_component GO:0005634 nucleus
cellular_component GO:0043226 organelle
molecular_function GO:0005488 binding
molecular_function GO:0003674 molecular_function
molecular_function GO:0005515 protein binding
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
PhyloFun GO Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0570.2 ID=Medtr0001s0570.2|Name=Medtr0001s0570.2|organism=Medicago truncatula|type=mRNA|length=4185bp
ATGCATCTTAATCAAGCTCTTATGGAGTCAAAGGCTGAAGAATACTCTGA
TGAAAACTGTCGCTTAGTTGAGGATACTCGGTATCCTGCAGACGAGGGTG
ATGGATCTTATGTTAGGGGCAGAACTTGTGAAAGATTGAAGCATTCTGAC
AGTGAAACCAGTAACATGCCTAGTATTTTCTCCAGTCACGATTCTCTATC
TGAAAATACCGAGAGTAAACAGATCATTTCAGAAAAGTGTCAGGATTCTA
AGTGTTTAGAAGGTCTTGATGATAGCATTTGTTGTATCAGTGGAGCCAGT
AATGCTAATTTAGTAAGTTGTAGTAATCAAATAACTTCAGACAAAATAAA
TATATCTTCTAGTTCAGCTTCAGTTAGTCTCTGTGTGCCACAAGGGTCTG
GAATTGCGCAATCTGTTGATATGTTGGGTTCATCTGAAATTCTCTCATCT
AAATATGCAGACATTCCGGAAAAATTGTCAGAATGCTGTATGGAAAATGT
CGATTCATCTCTGACCAAAGATAGAGAACCTATTATTGTTTCTGGTGAAA
AATCTCTTCCAGATAAGGGTGAATTTGTTAGTGGTACGGCCGAAGTGTCA
CAAAAAATGTATCCAAAGTCAGAAGCTGATGCTGACAACGATGTTAGTGT
TGCTGAAGATGGGGATCATAAATGTTCAGCCCCTGATGGGCTGCATGAGA
AGGCTGAGGAGCAGGATGAAGTACTTGGGATATCTGTACCTCAACCAGAA
GATGAGAGTGATGAATCAGATTTTGTTGAGCATGATGTAAAAGTATGTGA
CATCTGTGGAGATTCTGGTCGTGAGAACCTGCTTGCCATATGTAGTAGGT
GCAGTGATGGTGCAGAGCACACATACTGCATGAGGGAAATGCTTGAAAAA
GTGCCTGAAGGGGATTGGTTTTGTGAGGAATGCCAATATGCTGAAGAGAC
TGCCAACCAAAGATTGGAAGGAAAAAGTGGTCATAAAGTTAGTTCCACTT
CTCAAATTACTGGCAAAAGGTCTTCTGAAATCATGGAATTAGTTGCAGCA
GCAAAGAGGCGAGCCCTCGAATCACGCACTGGATCACCGAAGGCATCAAG
CCCCAGGAGATTAGTTCCATTGTCACGGGAGTCTTCATTCAAGAGCTTAG
ACAATGGAAAGGAGAAACCTGTTCAAACTTCAAGGAGAATGGGTACATTG
TTGAAATCTTGTTCATTCAACAACTTCAGTTCCAAATCAAGAGTCAAACT
TGATGATGATGTTCCTCAAAAGCAGAAAGGGGGTGGTGAACATGTCTCTA
AGAACACGGAGACTCCTATCAGGACAATAGGAAAACCAATGTCATTCAAA
TCCTCAAATTTGGGTCGTGCTACTGAATCAAAAGTTAAAATGCTTTCTCC
TAAGTCTGGAACTGCTCAGGATTTGAAAGGATCAAGCCTTGCAAAAGAAT
CAGGTGTATTTGACAGGAAATCTCTGTCTAGGATTGATCGGCCTGTCGTC
TGTTCAACTATGGCTAGTTCTGTCATTTCCACACACAATCAGAAGCTTAC
ACCTCGTGGTGAAACTGTTAAACCTTTAGCAATTAACTGCAACCGGGATT
TTAAAGTTAACCATGATGGGAAATCAAGTTCATTATCAAAGTCCGTTAAT
AATATAAGCAACAAAAGTTCAGAACCTCAAGTTATTTCAGAGAAAATGTC
AACCAGTGTGGATGACACTCAATTGGATGGGCTACCTCGATTACAAGAAA
CAGAAAACCAGGTTGACAAAACAAAAGATAGTTATACTCATCGTGTGAGG
TCAGATACTGATGCTTCAAAATCTCCGTTCTGTCATAAATGTAAAGATTT
TGGCCATGCTACAGAATGCTGTACAGTTAGTGTAGCACAAGAATTTGGTA
CTGATGGATCACTTAATGCCGTAAGTAGTCCAAAAGAGTCACATACAAGT
AATAGATTGAAAGCTGCAATTCAGGAAGCTTTGCTTAAAAGGCCTGAAAT
ACACAAGAAGAAAAATCTAAATGATCAAACTGATCAGTTTCCTCCATCAG
GCACAATCTTGAAATGTAAAGTCAGTTCTCAAGACCAAGTGGAGGTCTCT
GCTTCTAACACACTGAAAAATAGTATTTCTGTTGTAGAAATCAATGCCAG
GCAGGAAATGCTAGGGAATTCTACATCTGAAACGTCCAAATGTTTGTCTG
GTAACGATTTGAAGCAACTTAAAACTGATTTTTGCTCTCAACTGAAAAAG
TCAGATTCTGGTATTCCTGCTTCTGAAAAGCCTGTGTTGAGAGACTTGCC
ATATCATGCTTCGGCAAATTCAAGTGTTACATCAGAGAAGTCAGCCATTC
CAGAATACAAATACATATGGCAGGGTGTCTTTGAAGTGAATGGAAGTGGA
ATGTCTCCTGACCTTTATAACGGGATTCAAGCACATTTATCCTCGTGCGC
TTCCCCCAAGGTTCTTGATGTAGTGGACAAGTTCTTACCTGAAATTTCCC
TGCACGAAGTTTCTCGCTTGAGCACATGGCCTTCACATTTTCATCAATGT
GGTGCTAAAGAAGATAACATTGCTCTTTACTTCTTCGCCAAAGACATTGA
AAGTTACGAGAGACACTACAAGGGTCTGCTGGATCACATGATTAGACATG
ATTTAGCACTCAAAGGTTTTTTTGATGGCGTCGAACTTCTCATATTTGCT
TCCAATCAGCTCCCTGAAAATTCACAGCGTTGGAATATGCTGTTTTTTTT
ATGGGGCATATTTAGAGGGAGGAGGATTAATCATTCAGATTCTGCAAAAG
ATATTGCTTTACCTAGTTTGAATGTGGCGGTGTCAAATGAGAAGGATTTT
CCGACTGCTGTCATGACCTTGTCTGATACCCGCTGTTCACCAGTGCGCAT
CGATGAAGAATCAATAGCTTGTGGTGATATTTTCAGTGAACTTCCAGCCA
CTTCTGTTGACCAAGGTCATATTATGCTAAGTAGGGATTTTGATATAAAA
GAAACTATTTTTGACCAGACACATTTGGGTTCACAAGTAAACTTCGACAG
GCAAGATAGTAGAATCAGTGCCAAATCTTCGTCAAGGATTTCAACAAATG
GTATACAACCGTGTCCAGAAATGAATTCCACTGGTTCATCTCTGAAACAG
AAAGGTAGTTTGTCAGAGCATGGACTGCACAGAGGGTCAAAACCTCTGGA
AGAGGTGGGAATAATTGTAAGAGCTATGACTGTGGAAACAAAAGCTAATT
GTGGTATTTCTGTCAAGCAAGAGAACTCCGTGTCTTCAAGGATTCCTCAT
GTTGACAATCAAGAGGTACTCACTGCAAACAGCACCAGGAAAGATAAAAT
TTCAGAGAGAACAAACAATAATGAAAATCATCGAAGGCCTAAAAGGAAAG
AGAGAGAAGATGGTCTCAATATTAATGTAGAAGCAACTTTTCAGGGAGAT
CTGGCCATAGAAGCGGTCAGCTGTCGGCTACCTAATGTTATAAAAGTTGA
GCATATAGACCATTCTGACACAGTTATGGACGCTTCTGCAGCTGGCTGTC
AGGAAATGCCTCGGAATAAGATAGATGGGAAGTTGGAAGATACAGACAGT
TCTAGCAAGCTGCAGTCAGGTTTCAGTGGAATCTATGGATGTTACAGTTC
TGTAGCTAGGGATTCTTTGAATGGAAGTTCTGCATCACTTGTAAACGATT
TTGGTTCCGCATATTCAGTTGAAGACAAAGGATGCAAAGAAGCTTGTGAT
GAGAAAATCATCCACGAGGACCTTGGAACGACGGAAAAAACCTTCTTCCC
TATTGATACGCACAATACAAATGACTCACGATTGGTGCTGGATAGCATGT
CACTGAAAGGGCCTCACTGGAGCGGTGACCAATTTGAAGTTGGGATTCCA
CGTCTCGAGCTTGCGTTGGGAGGTGAAATGGAACAGTCACTGGAGGGTAC
GCGTCCTTTCTTTGCTGGGATAGCTGATAAGAAAAGTAACCAGGAAAAGA
CTCCAGATTGTTTGGAAGCTGAGCAAGAGGATGGCGACAGTGTTGCCGCA
TCTCTTTCCCTGTCTCTATCTTTCCCATCTTCAAACAAGGAACCCACAAA
ACATGCTTCAAAAGATGAGCATTTGCCTGATGTGCATCACATGAATTCTT
CGTTGCACCTTTTTGGGAGATTTACTGACAAATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding
GO:0003674molecular_function
GO:0005488binding
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0005634nucleus
GO:0043231intracellular membrane-bounded organelle
GO:0043226organelle
GO:0043227membrane-bounded organelle
GO:0043229intracellular organelle
GO:0044424intracellular part
GO:0044464cell part
Vocabulary: Biological Process
TermDefinition
GO:0008152metabolic process
GO:0006366transcription from RNA polymerase II promoter
GO:0006139nucleobase-containing compound metabolic process
GO:0006351transcription, DNA-templated
GO:0006355regulation of transcription, DNA-templated
GO:0006725cellular aromatic compound metabolic process
GO:0006807nitrogen compound metabolic process
GO:0008150biological_process
GO:0009058biosynthetic process
GO:0009059macromolecule biosynthetic process
GO:0009889regulation of biosynthetic process
GO:0009891positive regulation of biosynthetic process
GO:0009893positive regulation of metabolic process
GO:0009987cellular process
GO:0010467gene expression
GO:0010468regulation of gene expression
GO:0010556regulation of macromolecule biosynthetic process
GO:0010557positive regulation of macromolecule biosynthetic process
GO:0010604positive regulation of macromolecule metabolic process
GO:0010628positive regulation of gene expression
GO:0016070RNA metabolic process
GO:0045935positive regulation of nucleobase-containing compound metabolic process
GO:0045893positive regulation of transcription, DNA-templated
GO:0018130heterocycle biosynthetic process
GO:0019219regulation of nucleobase-containing compound metabolic process
GO:0019222regulation of metabolic process
GO:0019438aromatic compound biosynthetic process
GO:0031323regulation of cellular metabolic process
GO:0031325positive regulation of cellular metabolic process
GO:0031326regulation of cellular biosynthetic process
GO:0031328positive regulation of cellular biosynthetic process
GO:0032774RNA biosynthetic process
GO:0034641cellular nitrogen compound metabolic process
GO:0034645cellular macromolecule biosynthetic process
GO:0034654nucleobase-containing compound biosynthetic process
GO:0043170macromolecule metabolic process
GO:0044237cellular metabolic process
GO:0044238primary metabolic process
GO:0044249cellular biosynthetic process
GO:0044260cellular macromolecule metabolic process
GO:0044271cellular nitrogen compound biosynthetic process
GO:0046483heterocycle metabolic process
GO:0048518positive regulation of biological process
GO:0048522positive regulation of cellular process
GO:0050789regulation of biological process
GO:0050794regulation of cellular process
GO:0051171regulation of nitrogen compound metabolic process
GO:0051173positive regulation of nitrogen compound metabolic process
GO:0051252regulation of RNA metabolic process
GO:0051254positive regulation of RNA metabolic process
GO:0060255regulation of macromolecule metabolic process
GO:0065007biological regulation
GO:0071704organic substance metabolic process
GO:0080090regulation of primary metabolic process
GO:0090304nucleic acid metabolic process
GO:1901360organic cyclic compound metabolic process
GO:1901362organic cyclic compound biosynthetic process
GO:1901576organic substance biosynthetic process
GO:2000112regulation of cellular macromolecule biosynthetic process
GO:2001141regulation of RNA biosynthetic process