Overview
NameMedtr0001s0580.1
Unique NameMedtr0001s0580.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length420
Homology
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|342365838|gb|AEL30371.1| (TIR-NBS-LRR type disease resistance protein [Arachis hypogaea])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|357168326|ref|XP_003581593.1| (PREDICTED: craniofacial development protein 2-like [Brachypodium distachyon])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|400131576|emb|CCH50976.1| (T4.15 [Malus x robusta])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|475618781|gb|EMT30537.1| (Disease resistance protein RPP13 [Aegilops tauschii])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|475620656|gb|EMT31191.1| (Disease resistance RPP8-like protein 3 [Aegilops tauschii])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|473900760|gb|EMS49145.1| (Cysteine-rich receptor-like protein kinase 26 [Triticum urartu])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|225001270|gb|ACN78499.1| (putative endonuclease/exonuclease/phosphatase [Arachis hypogaea])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|512888069|ref|XP_004922026.1| (PREDICTED: uncharacterized protein LOC101739384 [Bombyx mori])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|512912725|ref|XP_004927726.1| (PREDICTED: uncharacterized protein LOC101746905 [Bombyx mori])
BLAST of Medtr0001s0580.1 vs. NCBI nr
Match: gi|475601698|gb|EMT24896.1| (Putative serine/threonine-protein kinase GCN2 [Aegilops tauschii])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0580.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|342365838|gb|AEL30371.1|3.495820e-3559.68TIR-NBS-LRR type disease resistance protein [Arach... [more]
gi|357168326|ref|XP_003581593.1|6.609900e-2042.02PREDICTED: craniofacial development protein 2-like... [more]
gi|400131576|emb|CCH50976.1|1.030150e-1942.67T4.15 [Malus x robusta][more]
gi|475618781|gb|EMT30537.1|1.087570e-1841.96Disease resistance protein RPP13 [Aegilops tauschi... [more]
gi|475620656|gb|EMT31191.1|3.345340e-1841.07Disease resistance RPP8-like protein 3 [Aegilops t... [more]
gi|473900760|gb|EMS49145.1|3.323400e-1740.18Cysteine-rich receptor-like protein kinase 26 [Tri... [more]
gi|225001270|gb|ACN78499.1|7.651050e-1077.14putative endonuclease/exonuclease/phosphatase [Ara... [more]
gi|512888069|ref|XP_004922026.1|1.304370e-933.02PREDICTED: uncharacterized protein LOC101739384 [B... [more]
gi|512912725|ref|XP_004927726.1|9.039510e-933.96PREDICTED: uncharacterized protein LOC101746905 [B... [more]
gi|475601698|gb|EMT24896.1|1.403380e-836.36Putative serine/threonine-protein kinase GCN2 [Aeg... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0580.1 ID=Medtr0001s0580.1|Name=Medtr0001s0580.1|organism=Medicago truncatula|type=mRNA|length=420bp
ATGAAGAATGAGTTTACTTTAAAGGAGAGGATTGTGTTAGGCCTCGACAG
CCAACGTAAAACTTTGTCAAATCTCTATGACATGGACCAAATACGAAATA
GTGTGAATGCTAGGTCGTTTCCCAGAGGAAATGCGCTGTATAGCTCGAGT
ACAGTGTCAAATGAGCAAGGGCCGCTGCATCGCCGCCTGGATATAGTGAA
AAATAAGCAAGGGTTCCCACATCTTCGTGAACGGGTGAGGGTAAAGAATC
TAGTTCATGAGAGTATGATTTGTTTTGGAACATGGAACACAGGTACTCTT
ATGGGAAAATCTATGGAAGTAGTAGACACTATGACTAGGAGGAGCATCAA
TTTTATGTGCCTACAAGAGACTAAGTGGGTGGAGAAAAATGCGAAAGAAT
TAGATAGTTCAGGATTTTAG
back to top