Overview
NameMedtr0001s0660.1
Unique NameMedtr0001s0660.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length1386
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0048856 anatomical structure development
biological_process GO:0008150 biological_process
biological_process GO:0032502 developmental process
biological_process GO:0008152 metabolic process
biological_process GO:0007275 multicellular organismal development
biological_process GO:0032501 multicellular organismal process
biological_process GO:0043581 mycelium development
biological_process GO:0055114 oxidation-reduction process
biological_process GO:0044707 single-multicellular organism process
biological_process GO:0044767 single-organism developmental process
biological_process GO:0044699 single-organism process
cellular_component GO:0005623 cell
cellular_component GO:0044464 cell part
cellular_component GO:0005575 cellular_component
cellular_component GO:0005622 intracellular
molecular_function GO:0005488 binding
molecular_function GO:0004090 carbonyl reductase (NADPH) activity
molecular_function GO:0003824 catalytic activity
molecular_function GO:0003674 molecular_function
molecular_function GO:0016491 oxidoreductase activity
molecular_function GO:0016614 oxidoreductase activity, acting on CH-OH group of donors
molecular_function GO:0016616 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
molecular_function GO:0008270 zinc ion binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00107.21506920-506558202-3221-11973.81.1e-2475.81.8e-21
PF08240.7507421-50704735-1592-10891.05e-3092.11.5e-26

Homology
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|502180185|ref|XP_004516585.1| (PREDICTED: alcohol dehydrogenase-like 5-like [Cicer arietinum])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|363807586|ref|NP_001242408.1| (uncharacterized protein LOC100798341 [Glycine max] >gi|255638987|gb|ACU19794.1| unknown [Glycine max])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|388507902|gb|AFK42017.1| (unknown [Lotus japonicus])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|356543227|ref|XP_003540064.1| (PREDICTED: alcohol dehydrogenase-like 2-like isoform 1 [Glycine max])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|367460047|ref|NP_001238395.2| (alcohol dehydrogenase-like [Glycine max])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|356543237|ref|XP_003540069.1| (PREDICTED: LOW QUALITY PROTEIN: alcohol dehydrogenase-like 2-like [Glycine max])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|356543229|ref|XP_003540065.1| (PREDICTED: alcohol dehydrogenase-like 2-like isoform 2 [Glycine max])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|224142703|ref|XP_002324694.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|225435026|ref|XP_002281265.1| (PREDICTED: alcohol dehydrogenase-like 1-like [Vitis vinifera])
BLAST of Medtr0001s0660.1 vs. NCBI nr
Match: gi|590639495|ref|XP_007029686.1| (GroES-like zinc-binding dehydrogenase family protein [Theobroma cacao] >gi|508718291|gb|EOY10188.1| GroES-like zinc-binding dehydrogenase family protein [Theobroma cacao])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0660.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502180185|ref|XP_004516585.1|0.000000e+083.91PREDICTED: alcohol dehydrogenase-like 5-like [Cice... [more]
gi|363807586|ref|NP_001242408.1|0.000000e+077.81uncharacterized protein LOC100798341 [Glycine max]... [more]
gi|388507902|gb|AFK42017.1|0.000000e+075.87unknown [Lotus japonicus][more]
gi|356543227|ref|XP_003540064.1|0.000000e+073.53PREDICTED: alcohol dehydrogenase-like 2-like isofo... [more]
gi|367460047|ref|NP_001238395.2|0.000000e+073.53alcohol dehydrogenase-like [Glycine max][more]
gi|356543237|ref|XP_003540069.1|0.000000e+072.73PREDICTED: LOW QUALITY PROTEIN: alcohol dehydrogen... [more]
gi|356543229|ref|XP_003540065.1|0.000000e+070.86PREDICTED: alcohol dehydrogenase-like 2-like isofo... [more]
gi|224142703|ref|XP_002324694.1|6.707140e-16961.76predicted protein [Populus trichocarpa][more]
gi|225435026|ref|XP_002281265.1|9.598710e-16561.39PREDICTED: alcohol dehydrogenase-like 1-like [Viti... [more]
gi|590639495|ref|XP_007029686.1|3.756310e-16260.70GroES-like zinc-binding dehydrogenase family prote... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
PhyloFun GO Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR002328Alcohol dehydrogenase, zinc-containing, conserved sitePROSITEPS00059ADH_ZINCcoord: 67..81
score
IPR011032GroES-likeSUPERFAMILY50129GroES-likecoord: 2..198
score: 1.1e-67coord: 323..373
score: 2.1
IPR016040NAD(P)-binding domainGENE3D3.40.50.720no descriptioncoord: 195..309
score: 2.5
IPR020843Polyketide synthase, enoylreductaseSMARTSM00829no descriptioncoord: 17..371
score: 0.
NoneNo IPR availableGENE3D3.90.180.10no descriptioncoord: 2..194
score: 1.7
NoneNo IPR availableSEGsegsegcoord: 195..207
score
NoneNo IPR availableSUPERFAMILY51735NAD(P)-binding Rossmann-fold domainscoord: 164..338
score: 4.3
NoneNo IPR availableSUPERFAMILY56672DNA/RNA polymerasescoord: 389..456
score: 5.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0660.1 ID=Medtr0001s0660.1|Name=Medtr0001s0660.1|organism=Medicago truncatula|type=mRNA|length=1386bp
ATGTCAAGAGCCAAACAGGTTATTACATGCAAAGCTGCTGTATGCTGGGG
GCTTGGAAAGCCTGTGACAGTGGAAGAGATACAAGTAGATCCACCAAAGG
CAAAAGAAGTTCGAGTTAAGATGCTATGTTCAAGTGTATGCCACACAGAC
ATATCAAGCCTTAAAGGATTTCCACATAATCAATTTCCTCTAGCACTTGG
ACATGAAGGAATTGGTGTTGTAGAGAGTATTGGTGATCAAGTAACAAATC
TAAAAGAAGGGGATTTCATAATTCCAACATACATAGGCGAGTGTGAAGAA
TGTGAGAATTGTGTTTCTGGGAAAACCAATTTGTGTTTGACACATCCTGT
GAGATTGACTGGTCTAATGCCAGATAACACTTCAAGGTTGTCTGTCCGAG
GCCAAACATTATACCATGTTTTGAGTTGTGCTTCATGGTCGGAATATGTG
GTGGTTGATATCAATTACCTTCTTAGAGTTGATCCAAACATTAATCTAGC
TTATGCTAGTTTCATCTCATGTGGGTTTTCAACTGGTTATGGAGCTTGTT
GGAAAGAAGCCAATATTGAAAGTGGTTCAACTGTAGCTGTTTTTGGTCTT
GGGGCTGTTGGATTAGGGGCAATAAGCGGGGCTAAGATGATGGGAGCAAG
TAAGATAATTGGGGTTGACAAAAACGAGATGAAGAGAGAAAAAGGAGAAG
CTTTTGGGATGACCCATTTTATAAATTCTAATGATTCTGATAAATCTGCT
TCAGAATTGGTTAAAGAGTTAAATGGAATGGGTGTAGATTATTGCATTGA
ATGTACTGGAGTAGCACCTTTGCTTACTGAATCTTTGGAAGCCACAAAAA
TGGGAACAGGTAAGGCAATTGCAGTTGGTATAGGAGCTGAACTTGTTGTA
CCGTTTGGACTTCTTGCCATTCAATTTGGTAGAACCTTAAAAGGTTCTGT
TTTTGGAGGCATAAAAGCCAAATCAGACCTTACCACCATAGCTAACAAAT
GTCAAAAACAGGAATTCCCTCTCCATGAACTTTTCACCCATGAGGTCCCT
TTGGTTGATATTGACAAAGCATTTGAGTTATTGAAAGATCCCACTTGTGT
CAAAGTTGTTATCAAGATACTCTCACCCCATCTCCTTTTTCAGCAAGCCA
TTTGCCCTCGCTTTCGCCGGTCCTCCACATACATTCGCGAACTCCACGCC
ATTACCACCGCCGTTAAGAAATGGCGTCAATATCTTCTAGGCCACCCCTT
TGTCATCTTCACAGACCATCAGAGCCTCAACGAACTGCTCACTCAAGTCA
TTCAAAGTCCTGAACAACAAATCTACCTGGCCAAACTCATGGGGTATGAC
TATTCCATCCATACAAATCTGGCAAAACAAATGTAG
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR002328Alcohol dehydrogenase, zinc-containing, conserved site
IPR011032GroES-like
IPR016040NAD(P)-binding domain
IPR020843Polyketide synthase, enoylreductase
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0008270zinc ion binding
GO:0016491oxidoreductase activity
GO:0003824catalytic activity
GO:0005488binding
GO:0003674molecular_function
GO:0004090carbonyl reductase (NADPH) activity
GO:0016614oxidoreductase activity, acting on CH-OH group of donors
GO:0016616oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
Vocabulary: Biological Process
TermDefinition
GO:0055114oxidation-reduction process
GO:0008152metabolic process
GO:0007275multicellular organismal development
GO:0008150biological_process
GO:0032501multicellular organismal process
GO:0032502developmental process
GO:0043581mycelium development
GO:0044699single-organism process
GO:0044707single-multicellular organism process
GO:0044767single-organism developmental process
GO:0048856anatomical structure development
Vocabulary: Cellular Component
TermDefinition
GO:0005622intracellular
GO:0005575cellular_component
GO:0005623cell
GO:0044464cell part