Overview
NameMedtr0001s0700.1
Unique NameMedtr0001s0700.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length204
Homology
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|261865353|gb|ACY01934.1| (hypothetical protein [Beta vulgaris])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|224138666|ref|XP_002322871.1| (predicted protein [Populus trichocarpa])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|596027311|ref|XP_007219241.1| (hypothetical protein PRUPE_ppa017823mg, partial [Prunus persica] >gi|462415703|gb|EMJ20440.1| hypothetical protein PRUPE_ppa017823mg, partial [Prunus persica])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|502146293|ref|XP_004506389.1| (PREDICTED: uncharacterized protein LOC101489118 [Cicer arietinum])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|77555192|gb|ABA97988.1| (Transposable element protein, putative, Retrotrans_gag [Oryza sativa Japonica Group])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|590651980|ref|XP_007033035.1| (Integrase-like protein [Theobroma cacao] >gi|508712064|gb|EOY03961.1| Integrase-like protein [Theobroma cacao])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|25411367|pir||E84493 (probable Athila retroelement ORF1 protein [imported] - Arabidopsis thaliana)
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|147770960|emb|CAN69709.1| (hypothetical protein VITISV_018584 [Vitis vinifera])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|32487720|emb|CAE05397.1| (OSJNBa0022F16.21 [Oryza sativa Japonica Group])
BLAST of Medtr0001s0700.1 vs. NCBI nr
Match: gi|3047073|gb|AAC13587.1| (contains similarity to retrotransposon-like proteins [Arabidopsis thaliana])
The following BLAST results are available for this feature:
BLAST of Medtr0001s0700.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 15
Match NameE-valueIdentityDescription
gi|261865353|gb|ACY01934.1|7.391080e-943.75hypothetical protein [Beta vulgaris][more]
gi|224138666|ref|XP_002322871.1|6.755520e-636.67predicted protein [Populus trichocarpa][more]
gi|596027311|ref|XP_007219241.1|9.061910e-635.94hypothetical protein PRUPE_ppa017823mg, partial [P... [more]
gi|502146293|ref|XP_004506389.1|1.316450e-550.00PREDICTED: uncharacterized protein LOC101489118 [C... [more]
gi|77555192|gb|ABA97988.1|3.555800e-536.23Transposable element protein, putative, Retrotrans... [more]
gi|590651980|ref|XP_007033035.1|3.776480e-541.27Integrase-like protein [Theobroma cacao] >gi|50871... [more]
gi|25411367|pir||E844934.800590e-536.51probable Athila retroelement ORF1 protein [importe... [more]
gi|147770960|emb|CAN69709.1|1.816310e-438.71hypothetical protein VITISV_018584 [Vitis vinifera... [more]
gi|32487720|emb|CAE05397.1|2.517310e-434.33OSJNBa0022F16.21 [Oryza sativa Japonica Group][more]
gi|3047073|gb|AAC13587.1|2.684640e-437.68contains similarity to retrotransposon-like protei... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
BlastP Analysis2014-08-26
Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0001s0700.1 ID=Medtr0001s0700.1|Name=Medtr0001s0700.1|organism=Medicago truncatula|type=mRNA|length=204bp
ATGGCTGAACGCACTCTCAAAGAGTATGCAACCCCATCTACGGATGAGCC
ACAAGCTATTATTGTGTACCCAACGGTTGAGGGTAACAATTTTGAAATTA
AGCCTGCACTACTTAACTTGGTGCAGCAAAACCAGTTTTCTAGATCACTC
ACTGAGGATCCCAATCTGCATATTTCAACTTTCTTCAGACTCAGTGGAAC
CTAG
back to top