Overview
NameMedtr0002s0020.1
Unique NameMedtr0002s0020.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length867
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
molecular_function GO:0005515 protein binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF14299.17700-8176120-2781-151127.91.3e-41128.31.4e-37

Homology
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|502157395|ref|XP_004510862.1| (PREDICTED: F-box protein PP2-A13-like isoform X1 [Cicer arietinum])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|356505068|ref|XP_003521314.1| (PREDICTED: F-box protein PP2-A13-like [Glycine max])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|356520469|ref|XP_003528884.1| (PREDICTED: F-box protein PP2-A13-like [Glycine max])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|590722541|ref|XP_007051924.1| (Phloem protein 2-A13 [Theobroma cacao] >gi|508704185|gb|EOX96081.1| Phloem protein 2-A13 [Theobroma cacao])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|224127502|ref|XP_002320090.1| (f-box family protein [Populus trichocarpa])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|225453740|ref|XP_002269833.1| (PREDICTED: F-box protein PP2-A13 [Vitis vinifera] >gi|296089069|emb|CBI38772.3| unnamed protein product [Vitis vinifera])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|470142282|ref|XP_004306840.1| (PREDICTED: F-box protein PP2-A13-like [Fragaria vesca subsp. vesca])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|596015259|ref|XP_007218786.1| (hypothetical protein PRUPE_ppa009695mg [Prunus persica] >gi|462415248|gb|EMJ19985.1| hypothetical protein PRUPE_ppa009695mg [Prunus persica])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|225426781|ref|XP_002282844.1| (PREDICTED: F-box protein PP2-A12 [Vitis vinifera])
BLAST of Medtr0002s0020.1 vs. NCBI nr
Match: gi|297742595|emb|CBI34744.3| (unnamed protein product [Vitis vinifera])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0020.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502157395|ref|XP_004510862.1|0.000000e+087.80PREDICTED: F-box protein PP2-A13-like isoform X1 [... [more]
gi|356505068|ref|XP_003521314.1|1.434670e-17482.64PREDICTED: F-box protein PP2-A13-like [Glycine max... [more]
gi|356520469|ref|XP_003528884.1|3.593930e-17482.64PREDICTED: F-box protein PP2-A13-like [Glycine max... [more]
gi|590722541|ref|XP_007051924.1|7.289760e-14469.44Phloem protein 2-A13 [Theobroma cacao] >gi|5087041... [more]
gi|224127502|ref|XP_002320090.1|1.068290e-14167.61f-box family protein [Populus trichocarpa][more]
gi|225453740|ref|XP_002269833.1|1.478200e-13869.04PREDICTED: F-box protein PP2-A13 [Vitis vinifera] ... [more]
gi|470142282|ref|XP_004306840.1|2.480780e-13866.55PREDICTED: F-box protein PP2-A13-like [Fragaria ve... [more]
gi|596015259|ref|XP_007218786.1|2.340700e-13564.69hypothetical protein PRUPE_ppa009695mg [Prunus per... [more]
gi|225426781|ref|XP_002282844.1|6.539010e-13466.55PREDICTED: F-box protein PP2-A12 [Vitis vinifera][more]
gi|297742595|emb|CBI34744.3|1.118820e-13366.55unnamed protein product [Vitis vinifera][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR001810F-box domain, cyclin-likePROFILEPS50181FBOXcoord: 19..65
score: 9
IPR022364F-box domain, Skp2-likeSUPERFAMILY81383F-box domaincoord: 12..70
score: 1.2
NoneNo IPR availableGENE3D1.20.1280.50no descriptioncoord: 22..63
score: 0.0

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0020.1 ID=Medtr0002s0020.1|Name=Medtr0002s0020.1|organism=Medicago truncatula|type=mRNA|length=867bp
ATGGGTGCTAATTTTTCCTCATGTGTATGTGATGGAGATGAGGATTGTAG
TATGAGGCCAAGGCTTGGGGATATACCAGAGAGTTGTGTGGCATTGGTGT
TGATGTATTTGGATCCACCGGATATATGTAAGCTAGCACGATTGAATAGG
GCGTTTCGTGATGCTTCTTTTGCCGATTTTGTTTGGGAATCGAAGTTGCC
TTTGAATTATGAGTTTATCATGGGAAAAGCTTTGGAGGATGATACTACTA
GTTCTAGTTCTGGTGCTGAATTAGGGAAGAGGGATATTTATGCAAGGCTT
TGTAAGCCTAATTTGTTTGACAATGGAACCAAGGAAATTTGGCTAGATAA
GAGGACTGGTGGGGTTTGTTTGGCAATTTCCTCCAAAGCGTTAAGGATTA
CAGGGATAGATGATCGCAGATATTGGAATCACATTTCAACTGAAGAGTCA
AGGTTCCATACAGTTGCTTATCTTCATCAAATATGGTGGCTTGAAGTGGA
AGGAGATATTGATTTCCAATTTCCAGTAGGGACATACAGCGTGTACTTCA
GACTTCACCTTGGCAGGTCATCCAAGAAGCTTGGACGACGAGTTTGCAAG
ACCGAGCACATCCATGGCTGGGATATTAAACCTGCAAAGTTTCAGCTGAC
GACTTCTGATGGTCAACGCGCTGTCTCCCATACTCATTTGGATAATCCAG
GGCACTGGATCCTCTACCATGTAGGAAACTTTGTTTCTAAGAATTCTAAT
GATTTGATGAAGGTCAAGTTTTCATTGTCTCAAATAGATTGCACTCATAC
AAAGGGTGGTCTGTGTGTTGACTCTGTGCTTATATGCAATAGTAGCAATG
TAAAAAAAGAAGCGTAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR001810F-box domain, cyclin-like
IPR022364F-box domain, Skp2-like
noIPRunintegrated
Vocabulary: Molecular Function
TermDefinition
GO:0005515protein binding