Overview
NameMedtr0002s0030.1
Unique NameMedtr0002s0030.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length465
Homology
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|356522650|ref|XP_003529959.1| (PREDICTED: uncharacterized protein LOC100797322 [Glycine max])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|356522570|ref|XP_003529919.1| (PREDICTED: uncharacterized protein LOC100813151 [Glycine max])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|502167634|ref|XP_004514203.1| (PREDICTED: uncharacterized protein LOC101507264 [Cicer arietinum])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|502101948|ref|XP_004491920.1| (PREDICTED: uncharacterized protein LOC101492155 isoform X2 [Cicer arietinum])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|502101951|ref|XP_004491921.1| (PREDICTED: uncharacterized protein LOC101492155 isoform X3 [Cicer arietinum])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|502101945|ref|XP_004491919.1| (PREDICTED: uncharacterized protein LOC101492155 isoform X1 [Cicer arietinum])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|225016160|gb|ACN78983.1| (Rpp4 candidate 3 [Glycine max])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|328447253|gb|AEB06131.1| (Rpp4 candidate R10 [Glycine max])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|328447249|gb|AEB06127.1| (Rpp4 candidate R3 [Glycine max])
BLAST of Medtr0002s0030.1 vs. NCBI nr
Match: gi|356560323|ref|XP_003548442.1| (PREDICTED: uncharacterized protein LOC100811732 [Glycine max])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0030.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 14
Match NameE-valueIdentityDescription
gi|356522650|ref|XP_003529959.1|2.493540e-1444.44PREDICTED: uncharacterized protein LOC100797322 [G... [more]
gi|356522570|ref|XP_003529919.1|1.507270e-1253.62PREDICTED: uncharacterized protein LOC100813151 [G... [more]
gi|502167634|ref|XP_004514203.1|3.103630e-851.56PREDICTED: uncharacterized protein LOC101507264 [C... [more]
gi|502101948|ref|XP_004491920.1|1.526140e-743.75PREDICTED: uncharacterized protein LOC101492155 is... [more]
gi|502101951|ref|XP_004491921.1|1.588550e-743.75PREDICTED: uncharacterized protein LOC101492155 is... [more]
gi|502101945|ref|XP_004491919.1|1.810820e-743.75PREDICTED: uncharacterized protein LOC101492155 is... [more]
gi|225016160|gb|ACN78983.1|4.761290e-753.73Rpp4 candidate 3 [Glycine max][more]
gi|328447253|gb|AEB06131.1|4.704000e-652.24Rpp4 candidate R10 [Glycine max][more]
gi|328447249|gb|AEB06127.1|5.424050e-652.24Rpp4 candidate R3 [Glycine max][more]
gi|356560323|ref|XP_003548442.1|4.071980e-553.23PREDICTED: uncharacterized protein LOC100811732 [G... [more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableSEGsegsegcoord: 132..148
score

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0030.1 ID=Medtr0002s0030.1|Name=Medtr0002s0030.1|organism=Medicago truncatula|type=mRNA|length=465bp
ATGTATCTTGTGACTAAAACAACATATGCAAGAAACTATATCTCTGAAGC
TAATCATACATTAACTCTGAATTGGATCGATACATCTGTCGTTAAAGACT
TGATAGCTGGTGTTTCTGTTGATTTTCCTTTGTTAAAACCAATTTGGCTC
AAGTCGGAGACAGTCCCAGACTGGTGTTTCTGCAATTCATTAGTTTCTTT
GGTTGTTGATGGGTTTGAGTTCTTATTTGATGTGATACTACCTTTTCATT
TACTTCCATTCCTAAGTAACCTGAAAACACTAGAACTACGGAACTGTAAT
TCTGTTAAGGCAGTATTTGTTTATACAAAGATTGGAACTCAAGGAGGGGA
AGGTGAAAGTAGAGGTCAAGATGAAGATAAAAGTCAAGATAAAGATGAAG
TGGAAGGTGAAAGTGTAGATGAAGACGAAGGTGATGATGAGGATAGGATA
ATATTCAAGCAATAA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
noIPRunintegrated