Overview
NameMedtr0002s0040.1
Unique NameMedtr0002s0040.1
TypemRNA
OrganismMedicago truncatula (Barrel Medic)
Sequence length885
GO Annotation
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
biological_process GO:0005975 carbohydrate metabolic process
molecular_function GO:0003824 catalytic activity
molecular_function GO:0043169 cation binding
PFam
Analysis Name: PFAM Analysis
Date Performed: 2014-08-26
PFAM TermGenome CoordinatesProtein CoordinatesDomain Coordinatesdomain_scoreexpected_domaintotal_scoreexpected_whole
PF00704.2393533-9301231-20417-19569.32.5e-2373.51.8e-20

Homology
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|502087868|ref|XP_004488666.1| (PREDICTED: chitinase 2-like [Cicer arietinum])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|502084741|ref|XP_004487751.1| (PREDICTED: chitinase 2-like [Cicer arietinum])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|396827|emb|CAA80979.1| (narbonin [Vicia narbonensis])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|396823|emb|CAA80983.1| (narbonin [Vicia narbonensis])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|396829|emb|CAA80981.1| (narbonin [Vicia pannonica])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|157832081|pdb|1NAR|A (Chain A, Crystal Structure Of Narbonin Refined At 1.8 Angstroms Resolution)
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|599768|emb|CAA86852.1| (putative narbonin [Glycine max])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|396825|emb|CAA80980.1| (narbonin [Vicia narbonensis])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|488782|emb|CAA83922.1| (narbonin [Vicia pannonica])
BLAST of Medtr0002s0040.1 vs. NCBI nr
Match: gi|1297074|emb|CAA96515.1| (narbonin [Vicia pannonica])
The following BLAST results are available for this feature:
BLAST of Medtr0002s0040.1 vs. NCBI nr
Analysis Date: 2014-08-26 (BlastP Analysis)
Total hits: 20
Match NameE-valueIdentityDescription
gi|502087868|ref|XP_004488666.1|2.749540e-9954.92PREDICTED: chitinase 2-like [Cicer arietinum][more]
gi|502084741|ref|XP_004487751.1|9.602110e-9753.54PREDICTED: chitinase 2-like [Cicer arietinum][more]
gi|396827|emb|CAA80979.1|9.480120e-7848.12narbonin [Vicia narbonensis][more]
gi|396823|emb|CAA80983.1|1.890950e-7748.12narbonin [Vicia narbonensis][more]
gi|396829|emb|CAA80981.1|4.571080e-7747.42narbonin [Vicia pannonica][more]
gi|157832081|pdb|1NAR|A5.511720e-7747.78Chain A, Crystal Structure Of Narbonin Refined At ... [more]
gi|599768|emb|CAA86852.1|2.239840e-7647.93putative narbonin [Glycine max][more]
gi|396825|emb|CAA80980.1|2.410790e-7647.44narbonin [Vicia narbonensis][more]
gi|488782|emb|CAA83922.1|7.617840e-7446.90narbonin [Vicia pannonica][more]
gi|1297074|emb|CAA96515.1|1.987020e-7346.05narbonin [Vicia pannonica][more]

Pages

back to top
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of M.truncatula2014-08-19
InterPro Annotations2014-08-26
BlastP Analysis2014-08-26
PFAM Analysis2014-08-26
InterPro
Analysis Name: InterPro Annotations
Date Performed: 2014-08-26
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
IPR0006772S globulinPRINTSPR005512SGLOBULINcoord: 13..26
score: 1.2e-24coord: 60..75
score: 1.2e-24coord: 77..95
score: 1.2e-24coord: 100..114
score: 1.2e-24coord: 251..270
score: 1.2
IPR013781Glycoside hydrolase, subgroup, catalytic coreGENE3D3.20.20.80no descriptioncoord: 33..275
score: 2.8
IPR017853Glycoside hydrolase, superfamilySUPERFAMILY51445(Trans)glycosidasescoord: 8..292
score: 1.7

Sequences
The following sequences are available for this feature:

mRNA sequence

>Medtr0002s0040.1 ID=Medtr0002s0040.1|Name=Medtr0002s0040.1|organism=Medicago truncatula|type=mRNA|length=885bp
ATGTCTCATCTCATCATCGGTGACAATGCTGTTGATCCATTCATTTTTCG
AGAATACATTGGCGTGAAGCCATACCCAGCTTCTCTTAATAATTTCCCAT
ATGAAATTATTATCGCCAAGCATTTCCATTTCATTTTAGGCTTTGCCAAT
GATAGTTACAACGAAGAAGGAAAAGGCACCGGAAATTTTAACGCCAATTG
GAATAGTGATTTCTTCGGTCCTCAAAATGTGATGGCTCTCAAGAGAAAGT
ATCCCCATGTCAAGGTGGTAATAAGCATTGGAGGTCGTGATGCTAACTTT
CCATTCTTTCCTGCTGCCAGAGAAGAATGGTGCGGCAATGCCGTAGATTC
GCTCAAAGAGATCATCCGATCATACAACGACTGTTCCGTCGAAGATAACA
TCTTAATTGATGGCATTGATATTTTCTATGACTACATCAATACCAATGAA
AAAGATTTCTCCAACTACGTTGGGGACGTTATAAATAGACTCAAGAAAGA
GGTACGTATCGATGTGGTGTCTATTGCTCCATCCCATGAAACTCATAAAC
ACTACAAGGAACTCTACTTGGCATGCACTGACGATATTAATTGGGTTAAC
TACCAATTCTACATGCAGCCTATCCCCTCAAAGAACGATTTTCTAAACCT
CTTTCTTAATCTTGCAAAAGAATATGATTCTAATAAACTCCTAGTAGGAG
GAAGCTCCGATCCAAGTGACGCAAATAATTTTAAACGAGAGGTCTTCATT
GAAGGCTGCAAGGAACTCGTCAAAAAAAGATTGATCCGTGGCATTTTCAT
TTGGAATGCTAATGACTCCGCCACCGAAGTCCCACCTTTCTCCCTTGAGA
AAAAGGCACAAGAGATCCTCACTAAAAAAGATTGA
back to top
Annotated Terms
The following terms have been associated with this mRNA:
Vocabulary: INTERPRO
TermDefinition
IPR0006772S globulin
IPR013781Glycoside hydrolase, subgroup, catalytic core
IPR017853Glycoside hydrolase, superfamily
Vocabulary: Molecular Function
TermDefinition
GO:0003824catalytic activity
GO:0043169cation binding
Vocabulary: Biological Process
TermDefinition
GO:0005975carbohydrate metabolic process